Orthologous regulated operons containing feoA gene
| Regulog: | Fur - Psychromonadaceae/Aeromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Aeromonas hydrophila subsp. hydrophila ATCC 7966 | ||||
|
Position: -38
Score: 5.01116 Sequence: AAAAGAGAATTATTATTGTTT
Locus tag: AHA_2744
Name: feoA Funciton: Ferrous iron transport protein A
Locus tag: AHA_2743
Name: feoB Funciton: Ferrous iron transport protein B
Locus tag: AHA_2742
Name: feoC Funciton: Ferrous iron transport protein C |
||||
| feoA-feoB-feoC | -38 | 5 | AAAAGAGAATTATTATTGTTT | AHA_2744 |
| Aeromonas salmonicida subsp. salmonicida A449 | ||||
|
Position: -38
Score: 4.64855 Sequence: AAAAGCGAATTATTATTGTTT
Locus tag: ASA_1629
Name: feoA Funciton: Ferrous iron transport protein A
Locus tag: ASA_1630
Name: feoB Funciton: Ferrous iron transport protein B
Locus tag: ASA_1631
Name: feoC Funciton: Ferrous iron transport protein C |
||||
| feoA-feoB-feoC | -38 | 4.6 | AAAAGCGAATTATTATTGTTT | ASA_1629 |
| Tolumonas auensis DSM 9187 | ||||
|
Position: -35
Score: 5.4523 Sequence: TATTAATAATGATTCTCAATA
Locus tag: Tola_2146
Name: feoA Funciton: Ferrous iron transport protein A
Locus tag: Tola_2145
Name: feoB Funciton: Ferrous iron transport protein B
Locus tag: Tola_2144
Name: feoC Funciton: Ferrous iron transport protein C |
||||
| feoA-feoB-feoC | -35 | 5.5 | TATTAATAATGATTCTCAATA | Tola_2146 |