Orthologous regulated operons containing PE36_21659 gene

Properties
Regulog:	Fur - Psychromonadaceae/Aeromonadales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria/Gamma

Built upon 111 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Moritella sp. PE36
Position: -71 Score: 5.61407 Sequence: TAGTGACAATGATTCTCATTT Locus tag: PE36_21674 Name: null Funciton: permease Locus tag: PE36_21669 Name: null Funciton: probable TonB-dependent receptor Locus tag: PE36_21664 Name: PE36_21664 Funciton: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1) Locus tag: PE36_21659 Name: null Funciton: ABC-type Fe3+-hydroxamate transport system, periplasmic component Locus tag: PE36_21654 Name: null Funciton: ferrichrome transport system permease protein FhuB
PE36_21674-PE36_21669-PE36_21664-PE36_21659-PE36_21654	-71	5.6	TAGTGACAATGATTCTCATTT	PE36_21674

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --