Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing PE36_21674 gene

Properties
Regulog: Fur - Psychromonadaceae/Aeromonadales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria/Gamma
Built upon 111 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Moritella sp. PE36
Position: -71
Score: 5.61407
Sequence: TAGTGACAATGATTCTCATTT
Locus tag: PE36_21674
Name: null
Funciton: permease
Locus tag: PE36_21669
Name: null
Funciton: probable TonB-dependent receptor
Locus tag: PE36_21664
Name: PE36_21664
Funciton: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
Locus tag: PE36_21659
Name: null
Funciton: ABC-type Fe3+-hydroxamate transport system, periplasmic component
Locus tag: PE36_21654
Name: null
Funciton: ferrichrome transport system permease protein FhuB
PE36_21674-PE36_21669-PE36_21664-PE36_21659-PE36_21654 -71 5.6 TAGTGACAATGATTCTCATTT PE36_21674