Orthologous regulated operons containing PE36_21664 gene
| Regulog: | Fur - Psychromonadaceae/Aeromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Moritella sp. PE36 | ||||
|
Position: -71
Score: 5.61407 Sequence: TAGTGACAATGATTCTCATTT
Locus tag: PE36_21674
Name: null Funciton: permease
Locus tag: PE36_21669
Name: null Funciton: probable TonB-dependent receptor
Locus tag: PE36_21664
Name: PE36_21664 Funciton: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
Locus tag: PE36_21659
Name: null Funciton: ABC-type Fe3+-hydroxamate transport system, periplasmic component
Locus tag: PE36_21654
Name: null Funciton: ferrichrome transport system permease protein FhuB |
||||
| PE36_21674-PE36_21669-PE36_21664-PE36_21659-PE36_21654 | -71 | 5.6 | TAGTGACAATGATTCTCATTT | PE36_21674 |