Orthologous regulated operons containing PE36_17605 gene

Properties
Regulog:	Fur - Psychromonadaceae/Aeromonadales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria/Gamma

Built upon 111 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Moritella sp. PE36
Position: -35 Score: 5.53547 Sequence: TAATACGAACAATTATCATTT Locus tag: PE36_17585 Name: PE36_17585 Funciton: Ferric anguibactin-binding protein Locus tag: PE36_17590 Name: PE36_17590 Funciton: catechol siderophore ABC transporter, permease protein Locus tag: PE36_17595 Name: PE36_17595 Funciton: ferric anguibactin transport system permease protein FatC Locus tag: PE36_17600 Name: PE36_17600 Funciton: ferric anguibactin transport ATP-binding protein Locus tag: PE36_17605 Name: null Funciton: vulnibactin utilization protein ViuB
PE36_17585-PE36_17590-PE36_17595-PE36_17600-PE36_17605	-35	5.5	TAATACGAACAATTATCATTT	PE36_17585

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --