Orthologous regulated operons containing hutR gene
Regulog: | Fur - Psychromonadaceae/Aeromonadales |
Regulator type: | Transcription factor |
Regulator family: | FUR |
Regulation mode: | repressor (activator) |
Biological process: | Iron homeostasis |
Effector: | Iron ion, (Fe2+) |
Phylum: | Proteobacteria/Gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Aeromonas hydrophila subsp. hydrophila ATCC 7966 | ||||
Position: -88
Score: 5.87786 Sequence: AAATGATAATGATTATCAATC
Position: -20
Score: 5.83741 Sequence: AAATAATAATTATTCTCAATA
Locus tag: AHA_1663
Name: hutR Funciton: TonB-dependent heme receptor HutR |
||||
hutR | -88 | 5.9 | AAATGATAATGATTATCAATC | AHA_1663 |
-20 | 5.8 | AAATAATAATTATTCTCAATA | ||
Aeromonas salmonicida subsp. salmonicida A449 | ||||
Position: -90
Score: 5.21701 Sequence: AAATGAGAATGATTCCCTTTA
Position: -31
Score: 4.82069 Sequence: GTTTGATAACAGTTCTCAATA
Locus tag: ASA_3328
Name: hutR Funciton: TonB-dependent heme receptor HutR |
||||
hutR | -90 | 5.2 | AAATGAGAATGATTCCCTTTA | ASA_3328 |
-31 | 4.8 | GTTTGATAACAGTTCTCAATA |