Orthologous regulated operons containing entC gene

Properties
Regulog:	Fur - Psychromonadaceae/Aeromonadales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria/Gamma

Built upon 111 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Aeromonas hydrophila subsp. hydrophila ATCC 7966
Position: -44 Score: 6.00891 Sequence: AACTGATAATCATTATCATTT Locus tag: AHA_2479 Name: null Funciton: Isochorismate synthase (EC 5.4.4.2) Locus tag: AHA_2478 Name: null Funciton: 2,3-dihydroxybenzoate-AMP ligase (EC 2.7.7.58) Locus tag: AHA_2477 Name: null Funciton: Isochorismatase (EC 3.3.2.1) of siderophore biosynthesis Locus tag: AHA_2476 Name: null Funciton: Enterobactin synthetase component F (EC 2.7.7.-) Locus tag: AHA_2475 Name: null Funciton: 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (EC 1.3.1.28)
AHA_2479-AHA_2478-AHA_2477-AHA_2476-AHA_2475	-44	6	AACTGATAATCATTATCATTT	AHA_2479
Aeromonas salmonicida subsp. salmonicida A449
Position: -119 Score: 6.28548 Sequence: AATTGATAATCATTATCATTT Locus tag: ASA_1838 Name: entC Funciton: Isochorismate synthase (EC 5.4.4.2) Locus tag: ASA_1839 Name: entE Funciton: 2,3-dihydroxybenzoate-AMP ligase (EC 2.7.7.58) Locus tag: ASA_1840 Name: entB Funciton: Isochorismatase (EC 3.3.2.1) of siderophore biosynthesis Locus tag: ASA_1841 Name: entF Funciton: Enterobactin synthetase component F (EC 2.7.7.-) Locus tag: ASA_1842 Name: entA Funciton: 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (EC 1.3.1.28)
entC-entE-entB-entF-entA	-119	6.3	AATTGATAATCATTATCATTT	ASA_1838

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --