Orthologous regulated operons containing hutD gene
| Regulog: | Fur - Psychromonadaceae/Aeromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Aeromonas hydrophila subsp. hydrophila ATCC 7966 | ||||
|
Position: -92
Score: 5.0469 Sequence: AATTGATAATCGCTTTCATTC
Locus tag: AHA_0966
Name: hutB Funciton: Hemin ABC transport system, periplasmic component
Locus tag: AHA_0965
Name: hutC Funciton: Hemin ABC transporter, permease protein
Locus tag: AHA_0964
Name: hutD Funciton: Hemin ABC transporter, ATP-binding protein |
||||
| hutB-hutC-hutD | -92 | 5 | AATTGATAATCGCTTTCATTC | AHA_0966 |
| Aeromonas salmonicida subsp. salmonicida A449 | ||||
|
Position: -92
Score: 5.0469 Sequence: AATTGATAATCGCTTTCATTC
Locus tag: ASA_3334
Name: hutB Funciton: Hemin ABC transport system, periplasmic component
Locus tag: ASA_3335
Name: hutC Funciton: Hemin ABC transporter, permease protein
Locus tag: ASA_3336
Name: hutD Funciton: Hemin ABC transporter, ATP-binding protein |
||||
| hutB-hutC-hutD | -92 | 5 | AATTGATAATCGCTTTCATTC | ASA_3334 |
| Moritella sp. PE36 | ||||
|
Position: -150
Score: 5.15592 Sequence: TAATGCAACCAATTCTCATTT
Locus tag: PE36_06587
Name: hutB Funciton: Hemin ABC transport system, periplasmic component
Locus tag: PE36_06582
Name: hutC Funciton: Hemin ABC transporter, permease protein
Locus tag: PE36_06577
Name: hutD Funciton: Hemin ABC transporter, ATP-binding protein |
||||
| hutB-hutC-hutD | -150 | 5.2 | TAATGCAACCAATTCTCATTT | PE36_06587 |