Orthologous regulated operons containing fhuE gene

Properties
Regulog:	Fur - Psychromonadaceae/Aeromonadales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria/Gamma

Built upon 111 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Aeromonas hydrophila subsp. hydrophila ATCC 7966
Position: -134 Score: 5.28778 Sequence: AGATGCAAATGATTAGCAATT Locus tag: AHA_4275 Name: null Funciton: Ferric hydroxamate outer membrane receptor FhuA Locus tag: AHA_4276 Name: fhuB Funciton: ABC transporter ATP-binding protein YojI Locus tag: AHA_4277 Name: fhuC Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), ATP-binding protein FhuC Locus tag: AHA_4278 Name: fhuD Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), periplasmic substrate binding protein FhuD Locus tag: AHA_4279 Name: fhuE Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), permease component FhuB
AHA_4275-fhuB-fhuC-fhuD-fhuE	-134	5.3	AGATGCAAATGATTAGCAATT	AHA_4275
Aeromonas salmonicida subsp. salmonicida A449
Position: -155 Score: 5.28778 Sequence: AGATGCAAATGATTAGCAATT Locus tag: ASA_4363 Name: fhuA Funciton: Ferric hydroxamate outer membrane receptor FhuA Locus tag: ASA_4364 Name: fhuB Funciton: ABC transporter ATP-binding protein YojI Locus tag: ASA_4365 Name: fhuC Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), ATP-binding protein FhuC Locus tag: ASA_4366 Name: fhuD Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), periplasmic substrate binding protein FhuD Locus tag: ASA_4367 Name: fhuE Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), permease component FhuB
fhuA-fhuB-fhuC-fhuD-fhuE	-155	5.3	AGATGCAAATGATTAGCAATT	ASA_4363
Tolumonas auensis DSM 9187
Position: -60 Score: 5.90495 Sequence: AATTGATAACAATTATCATCT Locus tag: Tola_1485 Name: fhuC Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), ATP-binding protein FhuC Locus tag: Tola_1486 Name: fhuD Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), periplasmic substrate binding protein FhuD Locus tag: Tola_1487 Name: fhuE Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), permease component FhuB
fhuC-fhuD-fhuE	-60	5.9	AATTGATAACAATTATCATCT	Tola_1485