Orthologous regulated operons containing fhuD gene
| Regulog: | Fur - Psychromonadaceae/Aeromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Aeromonas hydrophila subsp. hydrophila ATCC 7966 | ||||
|
Position: -134
Score: 5.28778 Sequence: AGATGCAAATGATTAGCAATT
Locus tag: AHA_4275
Name: null Funciton: Ferric hydroxamate outer membrane receptor FhuA
Locus tag: AHA_4276
Name: fhuB Funciton: ABC transporter ATP-binding protein YojI
Locus tag: AHA_4277
Name: fhuC Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), ATP-binding protein FhuC
Locus tag: AHA_4278
Name: fhuD Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), periplasmic substrate binding protein FhuD
Locus tag: AHA_4279
Name: fhuE Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), permease component FhuB |
||||
| AHA_4275-fhuB-fhuC-fhuD-fhuE | -134 | 5.3 | AGATGCAAATGATTAGCAATT | AHA_4275 |
| Aeromonas salmonicida subsp. salmonicida A449 | ||||
|
Position: -155
Score: 5.28778 Sequence: AGATGCAAATGATTAGCAATT
Locus tag: ASA_4363
Name: fhuA Funciton: Ferric hydroxamate outer membrane receptor FhuA
Locus tag: ASA_4364
Name: fhuB Funciton: ABC transporter ATP-binding protein YojI
Locus tag: ASA_4365
Name: fhuC Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), ATP-binding protein FhuC
Locus tag: ASA_4366
Name: fhuD Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), periplasmic substrate binding protein FhuD
Locus tag: ASA_4367
Name: fhuE Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), permease component FhuB |
||||
| fhuA-fhuB-fhuC-fhuD-fhuE | -155 | 5.3 | AGATGCAAATGATTAGCAATT | ASA_4363 |
| Tolumonas auensis DSM 9187 | ||||
|
Position: -60
Score: 5.90495 Sequence: AATTGATAACAATTATCATCT
Locus tag: Tola_1485
Name: fhuC Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), ATP-binding protein FhuC
Locus tag: Tola_1486
Name: fhuD Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), periplasmic substrate binding protein FhuD
Locus tag: Tola_1487
Name: fhuE Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), permease component FhuB |
||||
| fhuC-fhuD-fhuE | -60 | 5.9 | AATTGATAACAATTATCATCT | Tola_1485 |