Orthologous regulated operons containing PE36_02307 gene

Properties
Regulog:	Fur - Psychromonadaceae/Aeromonadales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria/Gamma

Built upon 111 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Aeromonas hydrophila subsp. hydrophila ATCC 7966
Position: -59 Score: 5.39528 Sequence: CAATGAGAATAGTTATCATTG Locus tag: AHA_4252 Name: PE36_02307 Funciton: TonB system biopolymer transport component; Chromosome segregation ATPase Locus tag: AHA_4251 Name: AHA_4251 Funciton: TonB system biopolymer transport component Locus tag: AHA_4250 Name: exbB2 Funciton: Ferric siderophore transport system, biopolymer transport protein ExbB Locus tag: AHA_4249 Name: exbD2 Funciton: Ferric siderophore transport system, biopolymer transport protein ExbD Locus tag: AHA_4248 Name: tonB2 Funciton: Ferric siderophore transport system, periplasmic binding protein TonB Locus tag: AHA_4247 Name: PE36_02282 Funciton: TPR domain protein, putative component of TonB system
PE36_02307-AHA_4251-exbB2-exbD2-tonB2-PE36_02282	-59	5.4	CAATGAGAATAGTTATCATTG	AHA_4252
Aeromonas salmonicida subsp. salmonicida A449
Position: -35 Score: 5.39528 Sequence: CAATGAGAATAGTTATCATTG Locus tag: ASA_4323 Name: PE36_02307 Funciton: TonB system biopolymer transport component; Chromosome segregation ATPase Locus tag: ASA_4322 Name: AHA_4251 Funciton: TonB system biopolymer transport component Locus tag: ASA_4321 Name: exbB2 Funciton: Ferric siderophore transport system, biopolymer transport protein ExbB Locus tag: ASA_4320 Name: exbD2 Funciton: Ferric siderophore transport system, biopolymer transport protein ExbD Locus tag: ASA_4319 Name: tonB2 Funciton: Ferric siderophore transport system, periplasmic binding protein TonB Locus tag: ASA_4318 Name: PE36_02282 Funciton: TPR domain protein, putative component of TonB system
PE36_02307-AHA_4251-exbB2-exbD2-tonB2-PE36_02282	-35	5.4	CAATGAGAATAGTTATCATTG	ASA_4323
Moritella sp. PE36
Position: -94 Score: 6.17115 Sequence: TAATGAAAATTGTTATCATTT Locus tag: PE36_02327 Name: PE36_02327 Funciton: Ferric siderophore receptor-like protein, TonB-dependent Locus tag: PE36_02322 Name: fecF Funciton: Iron(III) dicitrate transport system periplasmic substrate-binding transport protein Locus tag: PE36_02317 Name: fecD Funciton: Iron(III) dicitrate transport system permease protein FecD (TC 3.A.1.14.1) Locus tag: PE36_02312 Name: fecE Funciton: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1) Locus tag: PE36_02307 Name: PE36_02307 Funciton: TonB system biopolymer transport component; Chromosome segregation ATPase Locus tag: PE36_02302 Name: AHA_4251 Funciton: TonB system biopolymer transport component Locus tag: PE36_02297 Name: exbB2 Funciton: Ferric siderophore transport system, biopolymer transport protein ExbB Locus tag: PE36_02292 Name: exbD2 Funciton: Ferric siderophore transport system, biopolymer transport protein ExbD Locus tag: PE36_02287 Name: tonB2 Funciton: Ferric siderophore transport system, periplasmic binding protein TonB Locus tag: PE36_02282 Name: PE36_02282 Funciton: TPR domain protein, putative component of TonB system
PE36_02327-fecF-fecD-fecE-PE36_02307-AHA_4251-exbB2-exbD2-tonB2-PE36_02282	-94	6.2	TAATGAAAATTGTTATCATTT	PE36_02327