Orthologous regulated operons containing ATW7_00740 gene
Regulog: | Fur - Alteromonadales |
Regulator type: | Transcription factor |
Regulator family: | FUR |
Regulation mode: | repressor (activator) |
Biological process: | Iron homeostasis |
Effector: | Iron ion, (Fe2+) |
Phylum: | Proteobacteria/Gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Alteromonadales bacterium TW-7 | ||||
Position: -61
Score: 5.11584 Sequence: AAATAGAAATCATTACCATTA
Locus tag: ATW7_00730
Name: ATW7_00730 Funciton: Siderophore biosynthesis L-2,4-diaminobutyrate decarboxylase
Locus tag: ATW7_00735
Name: ATW7_00735 Funciton: Siderophore biosynthesis protein, monooxygenase
Locus tag: ATW7_00740
Name: ATW7_00740 Funciton: Siderophore related permease |
||||
ATW7_00730-ATW7_00735-ATW7_00740 | -61 | 5.1 | AAATAGAAATCATTACCATTA | ATW7_00730 |
Pseudoalteromonas tunicata D2 | ||||
Position: -123
Score: 4.53822 Sequence: GAATAGTATATATTCTCATTT
Locus tag: PTD2_05445
Name: ATW7_00730 Funciton: Siderophore biosynthesis L-2,4-diaminobutyrate decarboxylase
Locus tag: PTD2_05450
Name: ATW7_00735 Funciton: Siderophore biosynthesis protein, monooxygenase
Locus tag: PTD2_05455
Name: ATW7_00740 Funciton: Siderophore related permease |
||||
ATW7_00730-ATW7_00735-ATW7_00740 | -123 | 4.5 | GAATAGTATATATTCTCATTT | PTD2_05445 |