Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing ATW7_00730 gene

Properties
Regulog: Fur - Alteromonadales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria/Gamma
Built upon 142 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Alteromonadales bacterium TW-7
Position: -61
Score: 5.11584
Sequence: AAATAGAAATCATTACCATTA
Locus tag: ATW7_00730
Name: ATW7_00730
Funciton: Siderophore biosynthesis L-2,4-diaminobutyrate decarboxylase
Locus tag: ATW7_00735
Name: ATW7_00735
Funciton: Siderophore biosynthesis protein, monooxygenase
Locus tag: ATW7_00740
Name: ATW7_00740
Funciton: Siderophore related permease
ATW7_00730-ATW7_00735-ATW7_00740 -61 5.1 AAATAGAAATCATTACCATTA ATW7_00730
Pseudoalteromonas tunicata D2
Position: -123
Score: 4.53822
Sequence: GAATAGTATATATTCTCATTT
Locus tag: PTD2_05445
Name: ATW7_00730
Funciton: Siderophore biosynthesis L-2,4-diaminobutyrate decarboxylase
Locus tag: PTD2_05450
Name: ATW7_00735
Funciton: Siderophore biosynthesis protein, monooxygenase
Locus tag: PTD2_05455
Name: ATW7_00740
Funciton: Siderophore related permease
ATW7_00730-ATW7_00735-ATW7_00740 -123 4.5 GAATAGTATATATTCTCATTT PTD2_05445