Orthologous regulated operons containing fhuE_1 gene
| Regulog: | Fur - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Idiomarina loihiensis L2TR | ||||
|
Position: -66
Score: 5.18443 Sequence: AAATGATAACGATTCGTAGTT
Locus tag: IL1581
Name: fhuE_1 Funciton: Putative OMR family iron-siderophore receptor precursor |
||||
| fhuE_1 | -66 | 5.2 | AAATGATAACGATTCGTAGTT | IL1581 |