Orthologous regulated operons containing IL0799 gene
| Regulog: | Fur - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Idiomarina loihiensis L2TR | ||||
|
Position: -52
Score: 4.77727 Sequence: AAATGCAAATGATAATGATTA
Position: -46
Score: 5.35606 Sequence: AAATGATAATGATTACCGTTA
Locus tag: IL0798
Name: sodA Funciton: Manganese superoxide dismutase (EC 1.15.1.1)
Locus tag: IL0799
Name: null Funciton: Metal transporter, ZIP family |
||||
| sodA-IL0799 | -52 | 4.8 | AAATGCAAATGATAATGATTA | IL0798 |
| -46 | 5.4 | AAATGATAATGATTACCGTTA | ||