Orthologous regulated operons containing IL0109 gene
| Regulog: | Fur - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Idiomarina loihiensis L2TR | ||||
|
Position: -177
Score: 5.47754 Sequence: TATTGATACTGATTCTCATTT
Locus tag: IL0109
Name: null Funciton: Probable TonB-dependent receptor |
||||
| IL0109 | -177 | 5.5 | TATTGATACTGATTCTCATTT | IL0109 |