Orthologous regulated operons containing piu gene
| Regulog: | Fur - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Idiomarina loihiensis L2TR | ||||
|
Position: -52
Score: 4.70636 Sequence: ACAATATAATCATTCTCATTT
Locus tag: IL0069
Name: piu Funciton: Putaive Fe-regulated protein B |
||||
| piu | -52 | 4.7 | ACAATATAATCATTCTCATTT | IL0069 |
| Pseudoalteromonas atlantica T6c | ||||
|
Position: -51
Score: 5.62153 Sequence: TAATGAGAATGCTTCTTATTT
Locus tag: Patl_3414
Name: piu Funciton: Putaive Fe-regulated protein B
Locus tag: Patl_3413
Name: piuB Funciton: Uncharacterized iron-regulated membrane protein; Iron-uptake factor PiuB |
||||
| piu-piuB | -51 | 5.6 | TAATGAGAATGCTTCTTATTT | Patl_3414 |