Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing hmuS gene

Properties
Regulog: Fur - Alteromonadales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria/Gamma
Built upon 142 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Pseudoalteromonas tunicata D2
Position: -94
Score: 5.94187
Sequence: AAATGATAATACTTCTCATTA
Locus tag: PTD2_10208
Name: null
Funciton: TonB-dependent hemin , ferrichrome receptor
Locus tag: PTD2_10213
Name: null
Funciton: Hemin transport protein HmuS
PTD2_10208-PTD2_10213 -94 5.9 AAATGATAATACTTCTCATTA PTD2_10208