Orthologous regulated operons containing hmuR gene
Regulog: | Fur - Alteromonadales |
Regulator type: | Transcription factor |
Regulator family: | FUR |
Regulation mode: | repressor (activator) |
Biological process: | Iron homeostasis |
Effector: | Iron ion, (Fe2+) |
Phylum: | Proteobacteria/Gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Pseudoalteromonas tunicata D2 | ||||
Position: -94
Score: 5.94187 Sequence: AAATGATAATACTTCTCATTA
Locus tag: PTD2_10208
Name: null Funciton: TonB-dependent hemin , ferrichrome receptor
Locus tag: PTD2_10213
Name: null Funciton: Hemin transport protein HmuS |
||||
PTD2_10208-PTD2_10213 | -94 | 5.9 | AAATGATAATACTTCTCATTA | PTD2_10208 |