Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing MADE_01572 gene

Properties
Regulog: Fur - Alteromonadales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria/Gamma
Built upon 142 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Idiomarina loihiensis L2TR
Position: -59
Score: 6.15736
Sequence: TAATGAAAACCATTATCATTT
Locus tag: IL1577
Name: Patl_1817
Funciton: Uncharacterized protein conserved in bacteria
Locus tag: IL1576
Name: MADE_01572
Funciton: TonB-dependent receptor, putative
Patl_1817-MADE_01572 -59 6.2 TAATGAAAACCATTATCATTT IL1577
© 2009-2020 RegPrecise