Orthologous regulated operons containing IL1578 gene
| Regulog: | Fur - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Idiomarina loihiensis L2TR | ||||
|
Position: -105
Score: 6.15736 Sequence: AAATGATAATGGTTTTCATTA
Locus tag: IL1578
Name: null Funciton: putative iron-regulated membrane protein |
||||
| IL1578 | -105 | 6.2 | AAATGATAATGGTTTTCATTA | IL1578 |