Orthologous regulated operons containing OS145_11761 gene
| Regulog: | Fur - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Idiomarina baltica OS145 | ||||
|
Position: -63
Score: 5.30355 Sequence: ATTTGATAATTGTTCTTATTA
Locus tag: OS145_11766
Name: null Funciton: putative iron-regulated membrane protein
Locus tag: OS145_11761
Name: null Funciton: hypothetical protein |
||||
| OS145_11766-OS145_11761 | -63 | 5.3 | ATTTGATAATTGTTCTTATTA | OS145_11766 |
| Idiomarina loihiensis L2TR | ||||
|
Position: -85
Score: 5.36611 Sequence: AAATGAGAATTGTTCGCAACA
Position: -58
Score: 5.09626 Sequence: ATTTGATAATTGTTCGTATTT
Locus tag: IL2512
Name: null Funciton: putative iron-regulated membrane protein
Locus tag: IL2513
Name: null Funciton: hypothetical protein |
||||
| IL2512-IL2513 | -85 | 5.4 | AAATGAGAATTGTTCGCAACA | IL2512 |
| -58 | 5.1 | ATTTGATAATTGTTCGTATTT | ||