Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Patl_1143 gene

Properties
Regulog: Fur - Alteromonadales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria/Gamma
Built upon 142 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Pseudoalteromonas atlantica T6c
Position: -72
Score: 6.08624
Sequence: AATTGAAAATCATTCTCATTA
Locus tag: Patl_1142
Name: Patl_1142
Funciton: TonB-dependent siderophore receptor
Locus tag: Patl_1143
Name: null
Funciton: putative iron-regulated membrane protein
Patl_1142-Patl_1143 -72 6.1 AATTGAAAATCATTCTCATTA Patl_1142
© 2009-2020 RegPrecise