Orthologous regulated operons containing COG0748 gene
| Regulog: | Fur - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Idiomarina baltica OS145 | ||||
|
Position: -81
Score: 5.39068 Sequence: AAACGAAAACTATTTGCATTT
Locus tag: OS145_06449
Name: hmuT Funciton: Hemin ABC transporter, periplasmic component
Locus tag: OS145_06454
Name: hmuU Funciton: Hemin ABC transporter, permease protein
Locus tag: OS145_06459
Name: hmuV Funciton: Hemin ABC transporter, ATP-binding protein
Locus tag: OS145_06464
Name: COG0748 Funciton: Putative heme iron utilization protein |
||||
| hmuT-hmuU-hmuV-COG0748 | -81 | 5.4 | AAACGAAAACTATTTGCATTT | OS145_06449 |
| Idiomarina loihiensis L2TR | ||||
|
Position: -87
Score: 5.53221 Sequence: AAACGAAAATGATTTGCATTT
Locus tag: IL0113
Name: hmuT Funciton: Hemin ABC transporter, periplasmic component
Locus tag: IL0114
Name: hmuU Funciton: Hemin ABC transporter, permease protein
Locus tag: IL0115
Name: hmuV Funciton: Hemin ABC transporter, ATP-binding protein
Locus tag: IL0116
Name: COG0748 Funciton: Putative heme iron utilization protein |
||||
| hmuT-hmuU-hmuV-COG0748 | -87 | 5.5 | AAACGAAAATGATTTGCATTT | IL0113 |
| Pseudoalteromonas atlantica T6c | ||||
|
Position: -66
Score: 5.59969 Sequence: AAATGATAACGATTACTATTT
Locus tag: Patl_1486
Name: COG4771 Funciton: Outer membrane receptor for ferrienterochelin, TonB-dependent
Locus tag: Patl_1487
Name: null Funciton: hypothetical protein
Locus tag: Patl_1488
Name: hmuT Funciton: Hemin ABC transporter, periplasmic component
Locus tag: Patl_1489
Name: hmuU Funciton: Hemin ABC transporter, permease protein
Locus tag: Patl_1490
Name: hmuV Funciton: Hemin ABC transporter, ATP-binding protein
Locus tag: Patl_1491
Name: COG0748 Funciton: Putative heme iron utilization protein |
||||
| COG4771-Patl_1487-hmuT-hmuU-hmuV-COG0748 | -66 | 5.6 | AAATGATAACGATTACTATTT | Patl_1486 |