Orthologous regulated operons containing COG0748 gene

Properties
Regulog:	Fur - Alteromonadales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria/Gamma

Built upon 142 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Idiomarina baltica OS145
Position: -81 Score: 5.39068 Sequence: AAACGAAAACTATTTGCATTT Locus tag: OS145_06449 Name: hmuT Funciton: Hemin ABC transporter, periplasmic component Locus tag: OS145_06454 Name: hmuU Funciton: Hemin ABC transporter, permease protein Locus tag: OS145_06459 Name: hmuV Funciton: Hemin ABC transporter, ATP-binding protein Locus tag: OS145_06464 Name: COG0748 Funciton: Putative heme iron utilization protein
hmuT-hmuU-hmuV-COG0748	-81	5.4	AAACGAAAACTATTTGCATTT	OS145_06449
Idiomarina loihiensis L2TR
Position: -87 Score: 5.53221 Sequence: AAACGAAAATGATTTGCATTT Locus tag: IL0113 Name: hmuT Funciton: Hemin ABC transporter, periplasmic component Locus tag: IL0114 Name: hmuU Funciton: Hemin ABC transporter, permease protein Locus tag: IL0115 Name: hmuV Funciton: Hemin ABC transporter, ATP-binding protein Locus tag: IL0116 Name: COG0748 Funciton: Putative heme iron utilization protein
hmuT-hmuU-hmuV-COG0748	-87	5.5	AAACGAAAATGATTTGCATTT	IL0113
Pseudoalteromonas atlantica T6c
Position: -66 Score: 5.59969 Sequence: AAATGATAACGATTACTATTT Locus tag: Patl_1486 Name: COG4771 Funciton: Outer membrane receptor for ferrienterochelin, TonB-dependent Locus tag: Patl_1487 Name: null Funciton: hypothetical protein Locus tag: Patl_1488 Name: hmuT Funciton: Hemin ABC transporter, periplasmic component Locus tag: Patl_1489 Name: hmuU Funciton: Hemin ABC transporter, permease protein Locus tag: Patl_1490 Name: hmuV Funciton: Hemin ABC transporter, ATP-binding protein Locus tag: Patl_1491 Name: COG0748 Funciton: Putative heme iron utilization protein
COG4771-Patl_1487-hmuT-hmuU-hmuV-COG0748	-66	5.6	AAATGATAACGATTACTATTT	Patl_1486