Orthologous regulated operons containing Patl_2402 gene
| Regulog: | Fur - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Colwellia psychrerythraea 34H | ||||
|
Position: -66
Score: 5.90853 Sequence: AAATAATAACAATTATCATTA
Locus tag: CPS_4213
Name: Patl_2402 Funciton: Ferric aerobactin receptor |
||||
| Patl_2402 | -66 | 5.9 | AAATAATAACAATTATCATTA | CPS_4213 |
| Idiomarina baltica OS145 | ||||
|
Position: -52
Score: 5.95517 Sequence: TAATGAGAACAATTATCATCT
Position: -17
Score: 5.46783 Sequence: AAATGATAAGGATTCTCATGT
Locus tag: OS145_03090
Name: Patl_2402 Funciton: Ferric aerobactin receptor
Locus tag: OS145_03095
Name: pepSY Funciton: Uncharacterized iron-regulated membrane protein; Iron-uptake factor PiuB |
||||
| Patl_2402-pepSY | -52 | 6 | TAATGAGAACAATTATCATCT | OS145_03090 |
| -17 | 5.5 | AAATGATAAGGATTCTCATGT | ||
| Pseudoalteromonas atlantica T6c | ||||
|
Position: -27
Score: 5.99733 Sequence: AAATGATAATAATTAGCATTA
Locus tag: Patl_2402
Name: Patl_2402 Funciton: Ferric aerobactin receptor
Locus tag: Patl_2403
Name: pepSY Funciton: Uncharacterized iron-regulated membrane protein; Iron-uptake factor PiuB |
||||
| Patl_2402-pepSY | -27 | 6 | AAATGATAATAATTAGCATTA | Patl_2402 |
| Pseudoalteromonas haloplanktis TAC125 | ||||
|
Position: -49
Score: 5.1953 Sequence: TATTGTTAATAGTTATCATTA
Locus tag: PSHAb0286
Name: Patl_2402 Funciton: Ferric aerobactin receptor |
||||
| Patl_2402 | -49 | 5.2 | TATTGTTAATAGTTATCATTA | PSHAb0286 |
| Pseudoalteromonas tunicata D2 | ||||
|
Position: -23
Score: 5.87506 Sequence: AAATAAAAACAATTATCATTA
Locus tag: PTD2_01521
Name: Patl_2402 Funciton: Ferric aerobactin receptor |
||||
| Patl_2402 | -23 | 5.9 | AAATAAAAACAATTATCATTA | PTD2_01521 |