Orthologous regulated operons containing pepSY gene

Properties
Regulog:	Fur - Alteromonadales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria/Gamma

Built upon 142 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Alteromonadales bacterium TW-7
Position: -87 Score: 5.191 Sequence: AAATGAGAATCACTATCTTTT Locus tag: ATW7_00890 Name: ATW7_00890 Funciton: iron uptake protein Locus tag: ATW7_00895 Name: pepSY Funciton: iron-regulated membrane protein Locus tag: ATW7_00900 Name: ATW7_00900 Funciton: iron uptake protein
ATW7_00890-pepSY-ATW7_00900	-87	5.2	AAATGAGAATCACTATCTTTT	ATW7_00890
Colwellia psychrerythraea 34H
Position: -148 Score: 6.01659 Sequence: AAATGATAATGGTTTTTATTT Locus tag: CPS_0262 Name: ATW7_00890 Funciton: iron uptake protein Locus tag: CPS_0263 Name: pepSY Funciton: iron-regulated membrane protein Locus tag: CPS_0264 Name: ATW7_00900 Funciton: iron uptake protein
ATW7_00890-pepSY-ATW7_00900	-148	6	AAATGATAATGGTTTTTATTT	CPS_0262
Pseudoalteromonas atlantica T6c
Position: -59 Score: 5.32186 Sequence: AAATGATATTAATTACCATTC Locus tag: Patl_3803 Name: COG4774 Funciton: Outer membrane receptor for monomeric catechols, TonB-dependent Locus tag: Patl_3802 Name: ATW7_00890 Funciton: iron uptake protein Locus tag: Patl_3801 Name: pepSY Funciton: iron-regulated membrane protein
COG4774-ATW7_00890-pepSY	-59	5.3	AAATGATATTAATTACCATTC	Patl_3803
Pseudoalteromonas tunicata D2
Position: -83 Score: 5.2048 Sequence: AAATGAGAATTACTATCTTTT Locus tag: PTD2_01631 Name: ATW7_00890 Funciton: iron uptake protein Locus tag: PTD2_01626 Name: pepSY Funciton: iron-regulated membrane protein Locus tag: PTD2_01621 Name: ATW7_00900 Funciton: iron uptake protein
ATW7_00890-pepSY-ATW7_00900	-83	5.2	AAATGAGAATTACTATCTTTT	PTD2_01631