Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing pepSY gene

Properties
Regulog: Fur - Alteromonadales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria/Gamma
Built upon 142 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Alteromonadales bacterium TW-7
Position: -87
Score: 5.191
Sequence: AAATGAGAATCACTATCTTTT
Locus tag: ATW7_00890
Name: ATW7_00890
Funciton: iron uptake protein
Locus tag: ATW7_00895
Name: pepSY
Funciton: iron-regulated membrane protein
Locus tag: ATW7_00900
Name: ATW7_00900
Funciton: iron uptake protein
ATW7_00890-pepSY-ATW7_00900 -87 5.2 AAATGAGAATCACTATCTTTT ATW7_00890
Colwellia psychrerythraea 34H
Position: -148
Score: 6.01659
Sequence: AAATGATAATGGTTTTTATTT
Locus tag: CPS_0262
Name: ATW7_00890
Funciton: iron uptake protein
Locus tag: CPS_0263
Name: pepSY
Funciton: iron-regulated membrane protein
Locus tag: CPS_0264
Name: ATW7_00900
Funciton: iron uptake protein
ATW7_00890-pepSY-ATW7_00900 -148 6 AAATGATAATGGTTTTTATTT CPS_0262
Pseudoalteromonas atlantica T6c
Position: -59
Score: 5.32186
Sequence: AAATGATATTAATTACCATTC
Locus tag: Patl_3803
Name: COG4774
Funciton: Outer membrane receptor for monomeric catechols, TonB-dependent
Locus tag: Patl_3802
Name: ATW7_00890
Funciton: iron uptake protein
Locus tag: Patl_3801
Name: pepSY
Funciton: iron-regulated membrane protein
COG4774-ATW7_00890-pepSY -59 5.3 AAATGATATTAATTACCATTC Patl_3803
Pseudoalteromonas tunicata D2
Position: -83
Score: 5.2048
Sequence: AAATGAGAATTACTATCTTTT
Locus tag: PTD2_01631
Name: ATW7_00890
Funciton: iron uptake protein
Locus tag: PTD2_01626
Name: pepSY
Funciton: iron-regulated membrane protein
Locus tag: PTD2_01621
Name: ATW7_00900
Funciton: iron uptake protein
ATW7_00890-pepSY-ATW7_00900 -83 5.2 AAATGAGAATTACTATCTTTT PTD2_01631