Orthologous regulated operons containing CPS_0694 gene
| Regulog: | Fur - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Pseudoalteromonas tunicata D2 | ||||
|
Position: -85
Score: 6.02454 Sequence: AAATGATATTTATTATCATTA
Position: -29
Score: 5.87332 Sequence: AAATAAGATTTATTATCATTT
Locus tag: PTD2_09069
Name: null Funciton: Iron-regulated protein A precursor
Locus tag: PTD2_09074
Name: CPS_0695 Funciton: Probable thiol oxidoreductase with 2 cytochrome c heme-binding sites
Locus tag: PTD2_09079
Name: null Funciton: Probable thiol oxidoreductase with 2 cytochrome c heme-binding sites
Locus tag: PTD2_09084
Name: irpA Funciton: Iron-regulated protein A precursor |
||||
| PTD2_09069-CPS_0695-PTD2_09079-irpA | -85 | 6 | AAATGATATTTATTATCATTA | PTD2_09069 |
| -29 | 5.9 | AAATAAGATTTATTATCATTT | ||