Orthologous regulated operons containing fbpA gene
| Regulog: | Fur - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Alteromonadales bacterium TW-7 | ||||
|
Position: -31
Score: 5.39749 Sequence: TATTGATAATAATTACTATTT
Locus tag: ATW7_12358
Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein
Locus tag: ATW7_12353
Name: fbpB Funciton: Ferric iron ABC transporter, permease protein
Locus tag: ATW7_12348
Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein
Locus tag: ATW7_12343
Name: yfeK Funciton: Predicted iron-dependent peroxidase, Dyp-type family |
||||
| fbpA-fbpB-fbpC-yfeK | -31 | 5.4 | TATTGATAATAATTACTATTT | ATW7_12358 |
| Alteromonas macleodii 'Deep ecotype' | ||||
|
Position: 5
Score: 5.71778 Sequence: TAATGATAATAAGTATCATTT
Locus tag: MADE_00161
Name: null Funciton: putative orphan protein
Locus tag: MADE_00162
Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein
Locus tag: MADE_00163
Name: fbpB Funciton: Ferric iron ABC transporter, permease protein
Locus tag: MADE_00164
Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein |
||||
| MADE_00161-fbpA-fbpB-fbpC | 5 | 5.7 | TAATGATAATAAGTATCATTT | MADE_00161 |
| Colwellia psychrerythraea 34H | ||||
|
Position: -86
Score: 4.64584 Sequence: TAATGAGAGTGATTCGTATAT
Locus tag: CPS_1012
Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein
Locus tag: CPS_1013
Name: fbpB Funciton: Ferric iron ABC transporter, permease protein
Locus tag: CPS_1014
Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein |
||||
| fbpA-fbpB-fbpC | -86 | 4.6 | TAATGAGAGTGATTCGTATAT | CPS_1012 |
| Glaciecola sp. HTCC2999 | ||||
|
Position: -61
Score: 5.75173 Sequence: TATTGAGAATTATTCTCAATA
Locus tag: GHTCC_010100005814
Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein
Locus tag: GHTCC_010100005809
Name: fbpB Funciton: Ferric iron ABC transporter, permease protein
Locus tag: GHTCC_010100005804
Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein |
||||
| fbpA-fbpB-fbpC | -61 | 5.8 | TATTGAGAATTATTCTCAATA | GHTCC_010100005814 |
| Idiomarina baltica OS145 | ||||
|
Position: -83
Score: 5.53821 Sequence: AAATGAGAATGGCTATCATTA
Locus tag: OS145_11901
Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein
Locus tag: OS145_11896
Name: fbpB Funciton: Ferric iron ABC transporter, permease protein
Locus tag: OS145_11891
Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein |
||||
| fbpA-fbpB-fbpC | -83 | 5.5 | AAATGAGAATGGCTATCATTA | OS145_11901 |
| Idiomarina loihiensis L2TR | ||||
|
Position: -84
Score: 5.53821 Sequence: AAATGAGAATGGCTATCATTA
Locus tag: IL1059
Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein
Locus tag: IL1060
Name: fbpB Funciton: Ferric iron ABC transporter, permease protein
Locus tag: IL1061
Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein |
||||
| fbpA-fbpB-fbpC | -84 | 5.5 | AAATGAGAATGGCTATCATTA | IL1059 |
| Pseudoalteromonas atlantica T6c | ||||
|
Position: -32
Score: 6.07283 Sequence: AATTGATAATTATTCTCAATT
Locus tag: Patl_1596
Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein
Locus tag: Patl_1597
Name: fbpB Funciton: Ferric iron ABC transporter, permease protein
Locus tag: Patl_1598
Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein |
||||
| fbpA-fbpB-fbpC | -32 | 6.1 | AATTGATAATTATTCTCAATT | Patl_1596 |
| Pseudoalteromonas haloplanktis TAC125 | ||||
|
Position: -32
Score: 5.28491 Sequence: TATTGATAATAGTTATTATTC
Locus tag: PSHAa2663
Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein
Locus tag: PSHAa2662
Name: fbpB Funciton: Ferric iron ABC transporter, permease protein
Locus tag: PSHAa2661
Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein
Locus tag: PSHAa2660
Name: yfeK Funciton: Predicted iron-dependent peroxidase, Dyp-type family |
||||
| fbpA-fbpB-fbpC-yfeK | -32 | 5.3 | TATTGATAATAGTTATTATTC | PSHAa2663 |
| Pseudoalteromonas tunicata D2 | ||||
|
Position: -33
Score: 5.6142 Sequence: ATTTGATAATAATTCTTATTT
Locus tag: PTD2_08484
Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein
Locus tag: PTD2_08489
Name: fbpB Funciton: Ferric iron ABC transporter, permease protein
Locus tag: PTD2_08494
Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein
Locus tag: PTD2_08499
Name: yfeK Funciton: Predicted iron-dependent peroxidase, Dyp-type family |
||||
| fbpA-fbpB-fbpC-yfeK | -33 | 5.6 | ATTTGATAATAATTCTTATTT | PTD2_08484 |