Orthologous regulated operons containing yfeK gene
| Regulog: | Fur - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Alteromonadales bacterium TW-7 | ||||
|
Position: -31
Score: 5.39749 Sequence: TATTGATAATAATTACTATTT
Locus tag: ATW7_12358
Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein
Locus tag: ATW7_12353
Name: fbpB Funciton: Ferric iron ABC transporter, permease protein
Locus tag: ATW7_12348
Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein
Locus tag: ATW7_12343
Name: yfeK Funciton: Predicted iron-dependent peroxidase, Dyp-type family |
||||
| fbpA-fbpB-fbpC-yfeK | -31 | 5.4 | TATTGATAATAATTACTATTT | ATW7_12358 |
| Pseudoalteromonas atlantica T6c | ||||
|
Position: -260
Score: 4.57443 Sequence: TAATAATAACAATACTCACCT
Locus tag: Patl_0493
Name: yfeK Funciton: Predicted iron-dependent peroxidase, Dyp-type family |
||||
| yfeK | -260 | 4.6 | TAATAATAACAATACTCACCT | Patl_0493 |
| Pseudoalteromonas haloplanktis TAC125 | ||||
|
Position: -32
Score: 5.28491 Sequence: TATTGATAATAGTTATTATTC
Locus tag: PSHAa2663
Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein
Locus tag: PSHAa2662
Name: fbpB Funciton: Ferric iron ABC transporter, permease protein
Locus tag: PSHAa2661
Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein
Locus tag: PSHAa2660
Name: yfeK Funciton: Predicted iron-dependent peroxidase, Dyp-type family |
||||
| fbpA-fbpB-fbpC-yfeK | -32 | 5.3 | TATTGATAATAGTTATTATTC | PSHAa2663 |
| Pseudoalteromonas tunicata D2 | ||||
|
Position: -33
Score: 5.6142 Sequence: ATTTGATAATAATTCTTATTT
Locus tag: PTD2_08484
Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein
Locus tag: PTD2_08489
Name: fbpB Funciton: Ferric iron ABC transporter, permease protein
Locus tag: PTD2_08494
Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein
Locus tag: PTD2_08499
Name: yfeK Funciton: Predicted iron-dependent peroxidase, Dyp-type family |
||||
| fbpA-fbpB-fbpC-yfeK | -33 | 5.6 | ATTTGATAATAATTCTTATTT | PTD2_08484 |