Orthologous regulated operons containing yfeK gene

Properties
Regulog:	Fur - Alteromonadales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria/Gamma

Built upon 142 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Alteromonadales bacterium TW-7
Position: -31 Score: 5.39749 Sequence: TATTGATAATAATTACTATTT Locus tag: ATW7_12358 Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein Locus tag: ATW7_12353 Name: fbpB Funciton: Ferric iron ABC transporter, permease protein Locus tag: ATW7_12348 Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein Locus tag: ATW7_12343 Name: yfeK Funciton: Predicted iron-dependent peroxidase, Dyp-type family
fbpA-fbpB-fbpC-yfeK	-31	5.4	TATTGATAATAATTACTATTT	ATW7_12358
Pseudoalteromonas atlantica T6c
Position: -260 Score: 4.57443 Sequence: TAATAATAACAATACTCACCT Locus tag: Patl_0493 Name: yfeK Funciton: Predicted iron-dependent peroxidase, Dyp-type family
yfeK	-260	4.6	TAATAATAACAATACTCACCT	Patl_0493
Pseudoalteromonas haloplanktis TAC125
Position: -32 Score: 5.28491 Sequence: TATTGATAATAGTTATTATTC Locus tag: PSHAa2663 Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein Locus tag: PSHAa2662 Name: fbpB Funciton: Ferric iron ABC transporter, permease protein Locus tag: PSHAa2661 Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein Locus tag: PSHAa2660 Name: yfeK Funciton: Predicted iron-dependent peroxidase, Dyp-type family
fbpA-fbpB-fbpC-yfeK	-32	5.3	TATTGATAATAGTTATTATTC	PSHAa2663
Pseudoalteromonas tunicata D2
Position: -33 Score: 5.6142 Sequence: ATTTGATAATAATTCTTATTT Locus tag: PTD2_08484 Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein Locus tag: PTD2_08489 Name: fbpB Funciton: Ferric iron ABC transporter, permease protein Locus tag: PTD2_08494 Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein Locus tag: PTD2_08499 Name: yfeK Funciton: Predicted iron-dependent peroxidase, Dyp-type family
fbpA-fbpB-fbpC-yfeK	-33	5.6	ATTTGATAATAATTCTTATTT	PTD2_08484