Orthologous regulated operons containing modQ2 gene
Regulog: | ModE - Rhodospirillales |
Regulator type: | Transcription factor |
Regulator family: | ModE |
Regulation mode: | repressor (activator) |
Biological process: | Molybdopterin biosynthesis |
Effector: | Molybdate |
Phylum: | Proteobacteria/alpha |
![](logos/5915_large.png)
Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Magnetospirillum magneticum AMB-1 | ||||
Position: -47
Score: 7.03019 Sequence: TCGCTATATACATGAACTACATTTCGA
Locus tag: amb2951
Name: modA Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Locus tag: amb2952
Name: modQ2 Funciton: Predicted molybdenum delivery protein
Locus tag: amb2953
Name: modD Funciton: Molybdenum transport system protein ModD |
||||
modA-modQ2-modD | -47 | 7 | TCGCTATATACATGAACTACATTTCGA | amb2951 |