Orthologous regulated operons containing CHU_2423 gene

Properties
Regulog:	NrtR - Sphingobacteria
Regulator type:	Transcription factor
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Phylum:	Bacteroidetes

Built upon 4 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Cytophaga hutchinsonii ATCC 33406
Position: -52 Score: 6.93394 Sequence: TTTGCGTAATTTTTACACAAA Position: -1 Score: 6.78165 Sequence: ATTGCGTAATAATTACACAAA Locus tag: CHU_2422 Name: prs Funciton: Ribose-phosphate pyrophosphokinase (EC 2.7.6.1) Locus tag: CHU_2423 Name: null Funciton: hypothetical protein Locus tag: CHU_2424 Name: nadV Funciton: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)
prs-CHU_2423-nadV	-52	6.9	TTTGCGTAATTTTTACACAAA	CHU_2422
	-1	6.8	ATTGCGTAATAATTACACAAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --