Orthologous regulated operons containing PF00293 gene

Properties
Regulog:	NrtR - Sphingobacteria
Regulator type:	Transcription factor
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Phylum:	Bacteroidetes

Built upon 4 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Chitinophaga pinensis DSM 2588
Position: -83 Score: 6.63663 Sequence: TTTGTGTAAAAATTACGGAAA Position: -31 Score: 6.62369 Sequence: TTTGTGTAACAAATACACAAA Locus tag: Cpin_0606 Name: PF00293 Funciton: NUDIX hydrolase Locus tag: Cpin_0607 Name: nadV Funciton: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)
PF00293-nadV	-83	6.6	TTTGTGTAAAAATTACGGAAA	Cpin_0606
	-31	6.6	TTTGTGTAACAAATACACAAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --