Orthologous regulated operons containing nadF gene

Properties
Regulog:	NrtR - Micrococcineae
Regulator type:	Transcription factor
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Phylum:	Actinobacteria

Built upon 13 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Arthrobacter aurescens TC1
Position: -87 Score: 5.9121 Sequence: TTATCGTCATCTTGACAATAA Position: -42 Score: 6.15238 Sequence: TTATCGTCAAGTTGACGATAA Locus tag: AAur_3479 Name: PF01145 Funciton: band 7 protein Locus tag: AAur_3480 Name: nadF Funciton: ATP-NAD kinase, PpnK-type
PF01145-nadF	-87	5.9	TTATCGTCATCTTGACAATAA	AAur_3479
	-42	6.2	TTATCGTCAAGTTGACGATAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --