Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing modE gene

Properties
Regulog: ModE - Chlorobiales
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdopterin biosynthesis
Effector: Molybdate
Phylum: Chlorobi
Built upon 25 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Chlorobium limicola DSM 245
Position: -79
Score: 6.45903
Sequence: TACCGTTATACCTTTTATTATATAACGAAT
Locus tag: Clim_0676
Name: omp_mod
Funciton: Predicted molybdenum transport TonB-dependent receptor
Locus tag: Clim_0675
Name: modA
Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Locus tag: Clim_0674
Name: modB
Funciton: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
Locus tag: Clim_0673
Name: modE
Funciton: Molybdate-responsive transcriptional regulator ModE
Locus tag: Clim_0672
Name: moaA
Funciton: Molybdenum cofactor biosynthesis protein MoaA
omp_mod-modA-modB-modE-moaA -79 6.5 TACCGTTATACCTTTTATTATATAACGAAT Clim_0676
Pelodictyon luteolum DSM 273
Position: -156
Score: 6.09545
Sequence: TTTCGTTATATTCACACTTATATAACGAAT
Locus tag: Plut_1540
Name: omp_mod
Funciton: Predicted molybdenum transport TonB-dependent receptor
Locus tag: Plut_1541
Name: modA
Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Locus tag: Plut_1542
Name: modB
Funciton: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
Locus tag: Plut_1543
Name: modE
Funciton: Molybdate-responsive transcriptional regulator ModE
Locus tag: Plut_1544
Name: moaA
Funciton: Molybdenum cofactor biosynthesis protein MoaA
omp_mod-modA-modB-modE-moaA -156 6.1 TTTCGTTATATTCACACTTATATAACGAAT Plut_1540
Prosthecochloris aestuarii DSM 271
Position: -61
Score: 5.84598
Sequence: TGACGTTATTACATTAAAAACATAACGAAA
Locus tag: Paes_1636
Name: modA
Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Locus tag: Paes_1637
Name: modB
Funciton: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
Locus tag: Paes_1638
Name: modE
Funciton: Molybdate-responsive transcriptional regulator ModE
modA-modB-modE -61 5.8 TGACGTTATTACATTAAAAACATAACGAAA Paes_1636
Prosthecochloris vibrioformis DSM 265
Position: -47
Score: 4.8241
Sequence: CACCGTTATCACCTGAACAACACAACGAAA
Locus tag: Cvib_1353
Name: omp_mod
Funciton: Predicted molybdenum transport TonB-dependent receptor
Locus tag: Cvib_1354
Name: modE
Funciton: Molybdate-responsive transcriptional regulator ModE
Locus tag: Cvib_1355
Name: moaA
Funciton: Molybdenum cofactor biosynthesis protein MoaA
omp_mod-modE-moaA -47 4.8 CACCGTTATCACCTGAACAACACAACGAAA Cvib_1353