Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing prs gene

Properties
Regulog: NrtR - Clostridia-1
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Phylum: Firmicutes
Built upon 6 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Clostridium beijerincki NCIMB 8052
Position: -69
Score: 5.64995
Sequence: ATAGAATCAAATTGATATTAT
Locus tag: Cbei_2075
Name: nrtR
Funciton: Nudix-related transcriptional regulator NrtR
Locus tag: Cbei_2076
Name: prs
Funciton: Ribose-phosphate pyrophosphokinase (EC 2.7.6.1)
nrtR-prs -69 5.6 ATAGAATCAAATTGATATTAT Cbei_2075