Orthologous regulated operons containing y1337 gene

Properties
Regulog:	IscR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Phylum:	Proteobacteria/gamma

Built upon 45 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Yersinia pestis KIM
Position: -29 Score: 5.25629 Sequence: ATAGTTGAGTGAATTACTAGGTTAA Position: -4 Score: 6.57761 Sequence: ATAGTTGACTAAAACACTCAAGAAT Locus tag: y1333 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: y1334 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: y1335 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: y1336 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: y1337 Name: null Funciton: hypothetical Locus tag: y1338 Name: hscB Funciton: co-chaperone protein HscB Locus tag: y1339 Name: hscA Funciton: Chaperone protein HscA Locus tag: y1340 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system Locus tag: y1341 Name: yfhJ Funciton: putative Fe-S cluster assembly protein
iscR-iscS-iscU-iscA-y1337-hscB-hscA-fdx-yfhJ	-29	5.3	ATAGTTGAGTGAATTACTAGGTTAA	y1333
	-4	6.6	ATAGTTGACTAAAACACTCAAGAAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --