Orthologous regulated operons containing sdxX gene
| Regulog: | GntR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Gluconate utilization |
| Effector: | Gluconate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Yersinia pestis KIM | ||||
|
Position: -237
Score: 5.71908 Sequence: TCACGTTACCGGTAACATGT
Locus tag: y1651
Name: sdxX Funciton: putative 2-ketogluconate dehydrogenase |
||||
| sdxX | -237 | 5.7 | TCACGTTACCGGTAACATGT | y1651 |