Orthologous regulated operons containing Athe_0962 gene

Properties
Regulog:	Csac_2166 - Thermoanaerobacterales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Phylum:	Firmicutes

Built upon 5 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Anaerocellum thermophilum DSM 6725
Position: -50 Score: 7.50011 Sequence: AGTGTTATATAATTATATAACACT Locus tag: Athe_0959 Name: THA_1504 Funciton: hypothetical protein Locus tag: Athe_0960 Name: Csac_2166 Funciton: Transcriptional regulator, GntR family Locus tag: Athe_0961 Name: THA_1502 Funciton: ABC transporter, permease protein Locus tag: Athe_0962 Name: Athe_0962 Funciton: dipeptidyl aminopeptidase/acylaminoacyl-peptidase-like protein Locus tag: Athe_0963 Name: THA_1501 Funciton: ABC transporter, ATP-binding protein
THA_1504-Csac_2166-THA_1502-Athe_0962-THA_1501	-50	7.5	AGTGTTATATAATTATATAACACT	Athe_0959
Caldicellulosiruptor saccharolyticus DSM 8903
Position: -50 Score: 7.50011 Sequence: AGTGTTATATAATTATATAACACT Locus tag: Csac_2166 Name: Csac_2166 Funciton: hypothetical protein Locus tag: Csac_2165 Name: THA_1503 Funciton: Transcriptional regulator, GntR family Locus tag: Csac_2164 Name: THA_1502 Funciton: ABC transporter, permease protein Locus tag: Csac_2163 Name: Athe_0962 Funciton: dipeptidyl aminopeptidase/acylaminoacyl-peptidase-like protein Locus tag: Csac_2162 Name: THA_1501 Funciton: ABC transporter, ATP-binding protein
Csac_2166-THA_1503-THA_1502-Athe_0962-THA_1501	-50	7.5	AGTGTTATATAATTATATAACACT	Csac_2166

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --