Orthologous regulated operons containing CAC3561 gene
| Regulog: | YhcF - Clostridia-1 |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux |
| Effector: | |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Clostridium acetobutylicum ATCC 824 | ||||
|
Position: -174
Score: 6.15532 Sequence: GTGTACTATTTATGTAATACAC
Locus tag: CAC3561
Name: null Funciton: ABC-type transporter, permease component
Locus tag: CAC3560
Name: null Funciton: ABC-type transporter, ATPase component
Locus tag: CAC3559
Name: null Funciton: Membrane permease, predicted cation efflux pumps |
||||
| CAC3561-CAC3560-CAC3559 | -174 | 6.2 | GTGTACTATTTATGTAATACAC | CAC3561 |