Orthologous regulated operons containing yhcI3 gene

Properties
Regulog:	YhcF - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Phylum:	Firmicutes

Built upon 14 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Lactobacillus acidophilus NCFM
Position: -43 Score: 6.56192 Sequence: ACTGTAATAGATAAATAATACAGT Locus tag: LBA1189 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: LBA1188 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: LBA1187 Name: yhcI Funciton: ABC-type multidrug transport system, permease component Locus tag: LBA1186 Name: yhcI2 Funciton: ABC-type multidrug transport system, permease component Locus tag: LBA1184 Name: yhcI3 Funciton: ABC-type multidrug transport system, permease component
yhcF-yhcG-yhcI-yhcI2-yhcI3	-43	6.6	ACTGTAATAGATAAATAATACAGT	LBA1189
Lactobacillus helveticus DPC 4571
Position: -44 Score: 5.54546 Sequence: AGTGTAATAGACATGTAATACAGC Locus tag: lhv_1290 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: lhv_1289 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: lhv_1288 Name: yhcI Funciton: ABC-type multidrug transport system, permease component Locus tag: lhv_1287 Name: yhcI2 Funciton: ABC-type multidrug transport system, permease component Locus tag: lhv_1286 Name: yhcI3 Funciton: ABC-type multidrug transport system, permease component
yhcF-yhcG-yhcI-yhcI2-yhcI3	-44	5.5	AGTGTAATAGACATGTAATACAGC	lhv_1290

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --