Orthologous regulated operons containing yhcI gene

Properties
Regulog:	YhcF - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Phylum:	Firmicutes

Built upon 14 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Lactobacillus acidophilus NCFM
Position: -43 Score: 6.56192 Sequence: ACTGTAATAGATAAATAATACAGT Locus tag: LBA1189 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: LBA1188 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: LBA1187 Name: yhcI Funciton: ABC-type multidrug transport system, permease component Locus tag: LBA1186 Name: yhcI2 Funciton: ABC-type multidrug transport system, permease component Locus tag: LBA1184 Name: yhcI3 Funciton: ABC-type multidrug transport system, permease component
yhcF-yhcG-yhcI-yhcI2-yhcI3	-43	6.6	ACTGTAATAGATAAATAATACAGT	LBA1189
Lactobacillus brevis ATCC 367
Position: -39 Score: 6.56286 Sequence: AGTGTAATAGTAAAATATAACACT Locus tag: LVIS_2001 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: LVIS_2000 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: LVIS_1999 Name: yhcI Funciton: ABC-type multidrug transport system, permease component
yhcF-yhcG-yhcI	-39	6.6	AGTGTAATAGTAAAATATAACACT	LVIS_2001
Lactobacillus casei ATCC 334
Position: -40 Score: 6.91165 Sequence: AGTGTATTAGTAATCTAATACACT Locus tag: LSEI_1880 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: LSEI_1881 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: LSEI_1882 Name: yhcI Funciton: ABC-type multidrug transport system, permease component
yhcF-yhcG-yhcI	-40	6.9	AGTGTATTAGTAATCTAATACACT	LSEI_1880
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Position: -38 Score: 6.41754 Sequence: AGTGTATTAGGTAACTAGTACAGT Locus tag: LBUL_1563 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: LBUL_1562 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: LBUL_1561 Name: yhcI Funciton: ABC-type multidrug transport system, permease component
yhcF-yhcG-yhcI	-38	6.4	AGTGTATTAGGTAACTAGTACAGT	LBUL_1563
Lactobacillus helveticus DPC 4571
Position: -44 Score: 5.54546 Sequence: AGTGTAATAGACATGTAATACAGC Locus tag: lhv_1290 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: lhv_1289 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: lhv_1288 Name: yhcI Funciton: ABC-type multidrug transport system, permease component Locus tag: lhv_1287 Name: yhcI2 Funciton: ABC-type multidrug transport system, permease component Locus tag: lhv_1286 Name: yhcI3 Funciton: ABC-type multidrug transport system, permease component
yhcF-yhcG-yhcI-yhcI2-yhcI3	-44	5.5	AGTGTAATAGACATGTAATACAGC	lhv_1290
Lactobacillus johnsonii NCC 533
Position: -42 Score: 6.35666 Sequence: AGTGTAATAGATAAACCGTACACT Locus tag: LJ1302 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: LJ1301 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: LJ1300 Name: yhcI Funciton: ABC-type multidrug transport system, permease component Locus tag: LJ1299 Name: yhcI2 Funciton: ABC-type multidrug transport system, permease component
yhcF-yhcG-yhcI-yhcI2	-42	6.4	AGTGTAATAGATAAACCGTACACT	LJ1302
Lactobacillus plantarum WCFS1
Position: -39 Score: 6.14523 Sequence: ATTGTAATAGAAAAATAGAACACT Locus tag: lp_2615 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: lp_2614 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: lp_2613 Name: yhcI Funciton: ABC-type multidrug transport system, permease component
yhcF-yhcG-yhcI	-39	6.1	ATTGTAATAGAAAAATAGAACACT	lp_2615
Lactobacillus rhamnosus GG
Position: -40 Score: 6.63437 Sequence: AGTGTAATAGATAGCTAATACACT Locus tag: LGG_01937 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: LGG_01938 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: LGG_01939 Name: yhcI Funciton: ABC-type multidrug transport system, permease component
yhcF-yhcG-yhcI	-40	6.6	AGTGTAATAGATAGCTAATACACT	LGG_01937
Pediococcus pentosaceus ATCC 25745
Position: -37 Score: 6.50758 Sequence: AGTGTATTAGAAAACTAGTACACA Locus tag: PEPE_0054 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: PEPE_0053 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: PEPE_0052 Name: yhcI Funciton: ABC-type multidrug transport system, permease component
yhcF-yhcG-yhcI	-37	6.5	AGTGTATTAGAAAACTAGTACACA	PEPE_0054

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing yhcI gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --