Orthologous regulated operons containing sglT gene
| Regulog: | GalR/GalS - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor (activator) |
| Biological process: | Galactose utilization |
| Effector: | Galactose |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Proteus mirabilis HI4320 | ||||
|
Position: -249
Score: 4.7616 Sequence: TATTGTAACCGTTATCAAAC
Position: -58
Score: 5.70836 Sequence: AAGTGGAAACGTTTACATTA
Locus tag: PMI1946
Name: sglT Funciton: predicted sodium/galactose cotransporter |
||||
| sglT | -249 | 4.8 | TATTGTAACCGTTATCAAAC | PMI1946 |
| -58 | 5.7 | AAGTGGAAACGTTTACATTA | ||