Orthologous regulated operons containing ganF gene

Properties
Regulog:	GalR/GalS - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor (activator)
Biological process:	Galactose utilization
Effector:	Galactose
Phylum:	Proteobacteria/gamma

Built upon 78 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Erwinia carotovora subsp. atroseptica SCRI1043
Position: -335 Score: 5.60361 Sequence: TGGTGTAACCGTTTGCACAA Position: -229 Score: 4.76604 Sequence: TGGTGTAACCGTTACCCTAG Locus tag: ECA3175 Name: ganE Funciton: oligogalactan ABC transporter, substrate-binding periplasmic protein Locus tag: ECA3176 Name: ganF Funciton: oligogalactan ABC transporter, permease protein Locus tag: ECA3177 Name: ganG Funciton: oligogalactan ABC transporter, permease protein Locus tag: ECA3178 Name: ganA Funciton: galactanase Locus tag: ECA3179 Name: lacA Funciton: beta-galactosidase
ganE-ganF-ganG-ganA-lacA	-335	5.6	TGGTGTAACCGTTTGCACAA	ECA3175
	-229	4.8	TGGTGTAACCGTTACCCTAG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --