Orthologous regulated operons containing CBO2791 gene
| Regulog: | YtrA - Clostridia-1 |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux; Antibiotic resistance |
| Effector: | |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Clostridium botulinum A str. ATCC 3502 | ||||
|
Position: -84
Score: 6.92257 Sequence: AAGTGTATTAGGTGTAGTAGTACACTT
Locus tag: CBO2791
Name: null Funciton: Teicoplanin resistance protein
Locus tag: CBO2790
Name: ytrA Funciton: Transcriptional regulator, GntR family
Locus tag: CBO2789
Name: ytrB Funciton: ABC-type transport system, ATPase component
Locus tag: CBO2788
Name: ytrC Funciton: ABC-type transport system, permease component |
||||
| CBO2791-ytrA-ytrB-ytrC | -84 | 6.9 | AAGTGTATTAGGTGTAGTAGTACACTT | CBO2791 |