Orthologous regulated operons containing gnd gene

Properties
Regulog:	PckR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Central carbohydrate metabolism
Effector:
Phylum:	Proteobacteria/Alpha

Built upon 99 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Xanthobacter autotrophicus Py2
Position: -56 Score: 4.60501 Sequence: CATGTTAAACGATTTAACGG Locus tag: Xaut_1176 Name: gnd Funciton: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
gnd	-56	4.6	CATGTTAAACGATTTAACGG	Xaut_1176

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --