Orthologous regulated operons containing gnd gene
| Regulog: | PckR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Central carbohydrate metabolism |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Xanthobacter autotrophicus Py2 | ||||
|
Position: -56
Score: 4.60501 Sequence: CATGTTAAACGATTTAACGG
Locus tag: Xaut_1176
Name: gnd Funciton: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44) |
||||
| gnd | -56 | 4.6 | CATGTTAAACGATTTAACGG | Xaut_1176 |