Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing MCCL_0351 gene

Properties
Regulog: RbsR2 - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Firmicutes
Built upon 7 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Macrococcus caseolyticus JCSC5402
Position: -36
Score: 6.61836
Sequence: TTATGTAATCGGTTACACAA
Locus tag: MCCL_0348
Name: rbsR2
Funciton: Transcriptional repressor of ribose utilization RbsR2, LacI family
Locus tag: MCCL_0349
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: MCCL_0350
Name: null
Funciton: hypothetical protein
Locus tag: MCCL_0351
Name: null
Funciton: hypothetical protein
rbsR2-rbsK-MCCL_0350-MCCL_0351 -36 6.6 TTATGTAATCGGTTACACAA MCCL_0348
© 2009-2020 RegPrecise