Orthologous regulated operons containing MCCL_0350 gene
| Regulog: | RbsR2 - Staphylococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ribose utilization |
| Effector: | Ribose |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Macrococcus caseolyticus JCSC5402 | ||||
|
Position: -36
Score: 6.61836 Sequence: TTATGTAATCGGTTACACAA
Locus tag: MCCL_0348
Name: rbsR2 Funciton: Transcriptional repressor of ribose utilization RbsR2, LacI family
Locus tag: MCCL_0349
Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: MCCL_0350
Name: null Funciton: hypothetical protein
Locus tag: MCCL_0351
Name: null Funciton: hypothetical protein |
||||
| rbsR2-rbsK-MCCL_0350-MCCL_0351 | -36 | 6.6 | TTATGTAATCGGTTACACAA | MCCL_0348 |