Orthologous regulated operons containing lacP gene
| Regulog: | GalR - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Galactose utilization |
| Effector: | Galactose |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Vibrio vulnificus CMCP6 | ||||
|
Position: -96
Score: 5.19872 Sequence: TCATGAAAACGTTTCCATAG
Locus tag: VV21329
Name: lacP Funciton: predicted lactoporin
Locus tag: VV21328
Name: VV21328 Funciton: lactose operon periplasmic protein
Locus tag: VV2_1327
Name: lacZ Funciton: Beta-galactosidase (EC 3.2.1.23) |
||||
| lacP-VV21328-lacZ | -96 | 5.2 | TCATGAAAACGTTTCCATAG | VV21329 |