Orthologous regulated operons containing bglB gene

Properties
Regulog:	BglR - Vibrionales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Phylum:	Proteobacteria/gamma

Built upon 7 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Vibrio harveyi ATCC BAA-1116
Position: -60 Score: 5.46461 Sequence: CCATGAAAGCGGTTTCGGAG Locus tag: VIBHAR_06943 Name: bglR Funciton: Transcriptional regulator for beta-glucoside utilization, LacI family Locus tag: VIBHAR_06942 Name: bglE Funciton: Predicted beta-glucoside ABC transporter, periplasmic component Locus tag: VIBHAR_06941 Name: bglE Funciton: Predicted beta-glucoside ABC transporter, periplasmic component Locus tag: VIBHAR_06940 Name: bglF Funciton: Predicted beta-glucoside ABC transporter, permease component Locus tag: VIBHAR_06939 Name: bglG Funciton: Predicted beta-glucoside ABC transporter, permease component Locus tag: VIBHAR_06938 Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: VIBHAR_06937 Name: bglK Funciton: Predicted beta-glucoside ABC transporter, ATP-binding protein
bglR-bglE-bglE-bglF-bglG-bglB-bglK	-60	5.5	CCATGAAAGCGGTTTCGGAG	VIBHAR_06943
Vibrio splendidus LGP32
Position: -140 Score: 5.65031 Sequence: ATCTGTAAGCGCTTTCATGA Position: -41 Score: 5.00469 Sequence: TTTTGTAAGCGGTTACAAGC Locus tag: VS_II1392 Name: bglR Funciton: Transcriptional regulator for beta-glucoside utilization, LacI family Locus tag: VS_II1391 Name: bglE Funciton: Predicted beta-glucoside ABC transporter, periplasmic component Locus tag: VS_II1390 Name: bglF Funciton: Predicted beta-glucoside ABC transporter, permease component Locus tag: VS_II1389 Name: bglG Funciton: Predicted beta-glucoside ABC transporter, permease component Locus tag: VS_II1388 Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: VS_II1387 Name: bglK Funciton: Predicted beta-glucoside ABC transporter, ATP-binding protein Locus tag: VS_II1386 Name: VS_II1386 Funciton: Cellodextrin-phosphorylase (EC 2.4.1.49)
bglR-bglE-bglF-bglG-bglB-bglK-VS_II1386	-140	5.7	ATCTGTAAGCGCTTTCATGA	VS_II1392
	-41	5	TTTTGTAAGCGGTTACAAGC
Vibrio vulnificus CMCP6
Position: -48 Score: 5.57639 Sequence: GCATGAAAGCGGTTTCGAAA Locus tag: VV21282 Name: bglR Funciton: Transcriptional regulator for beta-glucoside utilization, LacI family Locus tag: VV21283 Name: bglE Funciton: Predicted beta-glucoside ABC transporter, periplasmic component Locus tag: VV21284 Name: bglF Funciton: Predicted beta-glucoside ABC transporter, permease component Locus tag: VV21286 Name: bglG Funciton: Predicted beta-glucoside ABC transporter, permease component Locus tag: VV21287 Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: VV21288 Name: bglK Funciton: Predicted beta-glucoside ABC transporter, ATP-binding protein
bglR-bglE-bglF-bglG-bglB-bglK	-48	5.6	GCATGAAAGCGGTTTCGAAA	VV21282