Orthologous regulated operons containing sgaB gene
| Regulog: | SgaR - Pasteurellales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ascorbate utilization |
| Effector: | Ascorbate-6-phosphate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Mannheimia succiniciproducens MBEL55E | ||||
|
Position: -65
Score: 5.86991 Sequence: AAATGTTACCGCTATCACAA
Position: -31
Score: 6.24637 Sequence: TATTGATAACGCTATCATTG
Locus tag: MS0149
Name: sgaA Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
Locus tag: MS0150
Name: sgaB Funciton: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
Locus tag: MS0151
Name: sgaT Funciton: Ascorbate-specific PTS system, EIIC component |
||||
| sgaA-sgaB-sgaT | -65 | 5.9 | AAATGTTACCGCTATCACAA | MS0149 |
| -31 | 6.2 | TATTGATAACGCTATCATTG | ||